|
You are here: Core Forms > Search Sequence > Sequence
 First |  Previous | | Next  | Last  |
Sequence |
| Name: |
Plasmid pTrp |
Description: |
Plasmid-Genom pTrp contains Plasmids with Genes for the biosynthesis of Trypthophan and Leucin. |
Type: |
Plasmid |
| NCBIAccession: |
NP_057963 |
Version: |
NP_057963.1 GI:10957101 |
Keywords: |
|
| DNAsequence: |
Buchnera.Aphidicola-pTrp.txt |
AAsequence: |
Buchnera.Aphidicola-pTrp_AA.txt |
Alignment: |
|
| FullNCBIdatasheet: |
|
BaseCount: |
240 |
Remarks: |
cacatccgat tttaatgctg tcgcccggac ctagtttgcc gaaacacgca ggatgcatgt
tagatttaat aaaaaaagtc aagggggaca ttcctatagt aggaatttgt ttaggtcatc
aagcaatagt ag AAGCGTATGGCGGCATTATC ggat ATGCAGGTGAAATATTCCATGGCA
a TCATGGCGGATTAATGATGCT tggtttag agatgtttga gggtgtaccg caaccactac |
| Comment: |
Auszug aus Plasmid-Genom pTrp enthalten Plasmide mit Genen für die Biosynthese von Trypthophan und Leucin. |
| Publication: |
AUTHORS Shigenobu,S., Watanabe,H., Hattori,M., Sakaki,Y. and Ishikawa,H.
TITLE Genome sequence of the endocellular bacterial symbiont of aphids
Buchnera sp. APS
JOURNAL Nature 407 (6800), 81-86 (2000)
PUBMED 10993077 |
| URL: |
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?dopt=GenPept&cmd=Retrieve&db=protein&list_uids=10957101#sequence_10957101 |
Organisation
(more...) |
| Acronym: |
|
 |
Website: |
http://www.biolytix.ch/ |
| Name: |
Biolytix AG |
Country: |
Switzerland |
| Postal Address: |
Biolytix AG<br>Peter Brodmann<br>Benkenstrasse 254<br>4108 Witterswil |
Phone: |
+41 (0)61 725 20 70 |
Fax: |
+41 (0)61 725 20 71 |
|
| Popular Name: |
Genus: |
Species: |
Class: |
Order: |
Family: |
|
Buchnera |
aphidicola |
Gammaproteobacteria |
Enterobacteriales |
Enterobacteriaceae |
|
You are here: Core Forms > Search Sequence > Sequence
|
Overview